ntrk3b

Ensembl ID:
ENSDARG00000077228
ZFIN ID:
ZDB-GENE-010126-4
Human Orthologue:
NTRK3
Human Description:
neurotrophic tyrosine kinase, receptor, type 3 [Source:HGNC Symbol;Acc:8033]
Mouse Orthologue:
Ntrk3
Mouse Description:
neurotrophic tyrosine kinase, receptor, type 3 Gene [Source:MGI Symbol;Acc:MGI:97385]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38019 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24620 Nonsense Available for shipment Available now
sa13864 Essential Splice Site Available for shipment Available now
sa38018 Nonsense Mutation detected in F1 DNA During 2017
sa30214 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38019
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091727 Essential Splice Site 259 684 5 15
Genomic Location (Zv9):
Chromosome 25 (position 12338860)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 11902299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCCGTCAAAACTGTGTACGCCCACTTTCTACACCCGCCTTTTGAAGG[T/A]ACGTAATTTTTATTGTTACTGTTGTTTTCTTATCGTCTCAACTTACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091727 Nonsense 314 684 9 15
Genomic Location (Zv9):
Chromosome 25 (position 12330323)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 11893762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGGCTTCGCCTGCGTTCTCCTCGTCGTTATGTTTGTGCTAATCAAC[A/T]AATATGGCAGACGCTCAAAGTTTGGCATGAAAGGTAAGCAAGTGTAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091727 Essential Splice Site 325 684 9 15
Genomic Location (Zv9):
Chromosome 25 (position 12330288)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 11893727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGCTAATCAACAAATATGGCAGACGCTCAAAGTTTGGCATGAAAGG[T/A]AAGCAAGTGTAAACTTTTCAGCGGGAAACTTGGCACTTAGCATTATTAGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091727 Nonsense 645 684 15 15
Genomic Location (Zv9):
Chromosome 25 (position 12146425)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 11709864
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAAGGACGGGTGCTAGAAAGGCCACGGCTCTGTCCCAAGGAAGTGTA[C/A]GACATTATGCTGGGGTGCTGGCAGAGGGAACCACAACAGAGGTTAAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091727 Nonsense 658 684 15 15
Genomic Location (Zv9):
Chromosome 25 (position 12146388)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 11709827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGGAAGTGTACGACATTATGCTGGGGTGCTGGCAGAGGGAACCACAA[C/T]AGAGGTTAAACATCAAAGACATCCAGAAAATTCTTTTTGCCTTGGGCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link