im:7160995

Ensembl ID:
ENSDARG00000077227
ZFIN ID:
ZDB-GENE-060810-162
Human Orthologue:
FBXL6
Human Description:
F-box and leucine-rich repeat protein 6 [Source:HGNC Symbol;Acc:13603]
Mouse Orthologue:
Fbxl6
Mouse Description:
F-box and leucine-rich repeat protein 6 Gene [Source:MGI Symbol;Acc:MGI:1354705]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7453 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109157 Missense 273 416 8 10
Genomic Location (Zv9):
Chromosome 19 (position 22846344)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22777724
KASP Assay ID:
554-4377.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATGACTGACAATGACCTGAACAATGTGCTCCATGGCTCCCCCAATCTG[C/T]GTGTGCTGGACCTACGTGGAGGTTCCCGCATCACACCCACTGGCCTCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link