enpp7

Ensembl ID:
ENSDARG00000077225
ZFIN ID:
ZDB-GENE-040724-13
Description:
Novel protein with type I phosphodiesterase/nucleotide pyrophosphatase domain [Source:UniProtKB/TrEM
Human Orthologue:
ENPP7
Human Description:
ectonucleotide pyrophosphatase/phosphodiesterase 7 [Source:HGNC Symbol;Acc:23764]
Mouse Orthologue:
Enpp7
Mouse Description:
ectonucleotide pyrophosphatase/phosphodiesterase 7 Gene [Source:MGI Symbol;Acc:MGI:3027917]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27987 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109153 Nonsense 475 501 5 6
Genomic Location (Zv9):
Chromosome 12 (position 34382146)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 32301106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGATTTTTATTGCTTGCGTTTGTGGTCATTACATCCTACAAAGTGCAT[A/T]AAAGACGCAAAGTGAATCAAAGGTACAGCCTAGATATGCATGAAGACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link