ENSDARG00000077221

Ensembl ID:
ENSDARG00000077221

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30720 Nonsense Mutation detected in F1 DNA During 2015
sa10492 Essential Splice Site Available for shipment Available now
sa10424 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa30720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113791 Nonsense 243 409 1 4
Genomic Location:
Chromosome 20 (position 47414264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGATTTTTAATCCCTACTTTGCTTAGCCTCAAGACAAAGCTATTTGAA[A/T]AGATGCCCCATTTGCTTTATAATTCATACATTGTTACCACTATCTGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113791 Essential Splice Site 322 409 2 4
ENSDART00000113791 Essential Splice Site 322 409 2 4
Genomic Location:
Chromosome 20 (position 47414013)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTRCAAAGTCTAGATACAGTGAGAGATGACAACGCTRTGAAATCTGATAA[G/C]TCAGAGAAAAWWTTTTTTGTCTGTCATAATGCCAAATCACYATCTGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113791 Essential Splice Site 322 409 2 4
ENSDART00000113791 Essential Splice Site 322 409 2 4
Genomic Location:
Chromosome 20 (position 47414013)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTRCAAAGTCTAGATACAGTGAGAGATGACAACGCTRTGAAATCTGATAA[G/C]TCAGAGAAAAWWTTTTTTGTCTGTCATAATGCCAAATCACYATCTGACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/260uhp7g