si:ch211-106h4.6

Ensembl ID:
ENSDARG00000077219
ZFIN ID:
ZDB-GENE-070705-16
Description:
Novel protein similar to vertebrate plexin domain containing 2 (PLXDC2) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
PLXDC2
Human Description:
plexin domain containing 2 [Source:HGNC Symbol;Acc:21013]
Mouse Orthologue:
Plxdc2
Mouse Description:
plexin domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1914698]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39851 Nonsense Mutation detected in F1 DNA During 2017
sa31284 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111038 Nonsense 166 558 4 13
ENSDART00000134541   None 65 None 2
ENSDART00000140561 Nonsense 166 368 4 10
Genomic Location (Zv9):
Chromosome 2 (position 31333121)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31634181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACAGAGAGTCAATATGTCTTTTGATTTTCCTTTCTATGGACATTCAT[T/A]AAGAAAAATCTATGTAGCAACAGGAGGTGAGAGCAATTTTTTATACAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111038 Essential Splice Site 289 558 8 13
ENSDART00000134541   None 65 None 2
ENSDART00000140561 Essential Splice Site 289 368 8 10
Genomic Location (Zv9):
Chromosome 2 (position 31335404)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31636464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTCATTTTGTGGTTTTAATAAATCCTCTTTCATCTTTTTCCATGATA[G/C]ATGTTTGGAGGAGAACTATATATGAGTATCATCGTGTAGAGCTCTTAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link