EIF4G3 (2 of 2)

Ensembl ID:
ENSDARG00000077215
Description:
eukaryotic translation initiation factor 4 gamma, 3 [Source:HGNC Symbol;Acc:3298]
Human Orthologue:
EIF4G3
Human Description:
eukaryotic translation initiation factor 4 gamma, 3 [Source:HGNC Symbol;Acc:3298]
Mouse Orthologue:
Eif4g3
Mouse Description:
eukaryotic translation initiation factor 4 gamma, 3 Gene [Source:MGI Symbol;Acc:MGI:1923935]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2588 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2588
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111576 Nonsense 702 1561 13 31
Genomic Location:
Chromosome 11 (position 28736270)
KASP Assay ID:
554-2607.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGTCTGTCAGTGATGATGTTCAGCTCAAGAAGGCAGAAAATGCTTGG[A/T]AACCTGGGATGAAGAGAGAGGGTGTCGCAGAGGACCCAGAAACCATCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rtdag4zy