EIF4G3 (2 of 2)

Ensembl ID:
ENSDARG00000077215
Description:
eukaryotic translation initiation factor 4 gamma, 3 [Source:HGNC Symbol;Acc:3298]
Human Orthologue:
EIF4G3
Human Description:
eukaryotic translation initiation factor 4 gamma, 3 [Source:HGNC Symbol;Acc:3298]
Mouse Orthologue:
Eif4g3
Mouse Description:
eukaryotic translation initiation factor 4 gamma, 3 Gene [Source:MGI Symbol;Acc:MGI:1923935]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38848 Nonsense Mutation detected in F1 DNA During 2016
sa2588 Nonsense F2 line generated During 2016
sa35102 Nonsense Mutation detected in F1 DNA During 2016
sa27796 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111576 Nonsense 530 1561 10 31
Genomic Location:
Chromosome 11 (position 28741715)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGCTCTGCTGGAGATGAGATGGTCTTGCAGTCAAGCTTAGGGACCTA[C/A]AGCAGCCCCTTTACAGTGCCTGAGCACCAGGAGAAGCACTCTGAAGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2588
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111576 Nonsense 702 1561 13 31
Genomic Location:
Chromosome 11 (position 28736270)
KASP Assay ID:
554-2607.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGTCTGTCAGTGATGATGTTCAGCTCAAGAAGGCAGAAAATGCTTGG[A/T]AACCTGGGATGAAGAGAGAGGGTGTCGCAGAGGACCCAGAAACCATCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111576 Nonsense 1194 1561 23 31
Genomic Location:
Chromosome 11 (position 28717056)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAGAGACGCTGCTGGTCAGCGGTGTTTCAGAGAAGCCTGTCCTGTCT[G/T]AAGAGGAGATCGAGCGGAAGTCCAAAGCTATCATTGATGAATTTCTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111576 Nonsense 1534 1561 31 31
Genomic Location:
Chromosome 11 (position 28706536)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAGAGGACGCTTTCTATCAATGGGAGACGAGTAAAGACCCGACAGAG[C/T]AGCTGGGAAAAGGCGTAGCGCTGAAGTCTGTGAACGCTTTCTTCACCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link