MOCS2

Ensembl ID:
ENSDARG00000077202
Description:
molybdenum cofactor synthesis 2 [Source:HGNC Symbol;Acc:7193]
Human Orthologue:
MOCS2
Human Description:
molybdenum cofactor synthesis 2 [Source:HGNC Symbol;Acc:7193]
Mouse Orthologue:
Mocs2
Mouse Description:
molybdenum cofactor synthesis 2 Gene [Source:MGI Symbol;Acc:MGI:1336894]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11072 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11072
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110628 Nonsense 25 159 1 4
Genomic Location:
Chromosome 10 (position 9043065)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAATAACTCTCACCACTGACAAACTTTYTGCTGACAGAGTGTCTGAAT[C/A]GGTTACATGTCCTTCCTGTGGTGCTGTTTCTCTGTTCATTGGTCAGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5ewehfrn