myo7bb

Ensembl ID:
ENSDARG00000077201
ZFIN ID:
ZDB-GENE-070912-482
Description:
Novel protein similar to vertebrate myosin VIIA (MYO7A) [Source:UniProtKB/TrEMBL;Acc:B0S8H4]
Human Orthologue:
MYO7B
Human Description:
myosin VIIB [Source:HGNC Symbol;Acc:7607]
Mouse Orthologue:
Myo7b
Mouse Description:
myosin VIIB Gene [Source:MGI Symbol;Acc:MGI:107709]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32907 Nonsense Mutation detected in F1 DNA During 2016
sa19737 Essential Splice Site Available for shipment Available now
sa17781 Nonsense Available for shipment Available now
sa32906 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109515 Nonsense 556 2089 13 51
ENSDART00000136179   None 457 None 12
ENSDART00000139747   None 363 None 7
ENSDART00000141621 Nonsense 505 565 11 12
ENSDART00000144928   None 323 None 7
Genomic Location (Zv9):
Chromosome 2 (position 22373218)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23259923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCATCGGATACATTTTGGTGTTCAACACTTTGCTGGGTTGGTTTATTA[T/A]GACTGCGAAGGTACAATTCATCGATTATTTACTGTCCCATGACATATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109515 Essential Splice Site 664 2089 None 51
ENSDART00000136179   None 457 None 12
ENSDART00000139747   None 363 None 7
ENSDART00000141621   None 565 None 12
ENSDART00000144928 Essential Splice Site 40 323 None 7
Genomic Location (Zv9):
Chromosome 2 (position 22371530)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23258235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGTGAGGACGCTTTTAAGATGACGTTTTCTCTTTATTTTCCTCATC[A/C]GGTTTTTAACAGAGAGCTCTGCATGCAGCAACTTCGCTACTCTGGAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109515 Nonsense 1124 2089 30 51
ENSDART00000136179   None 457 None 12
ENSDART00000139747   None 363 None 7
ENSDART00000141621   None 565 None 12
ENSDART00000144928   None 323 None 7
Genomic Location (Zv9):
Chromosome 2 (position 22357594)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23244299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWGAAATTTATTGTCAGATCTGTAAGCAGCTGACAGGCAATAAAAACCGC[A/T]AAAGTGTAAACAGAGGCTGGATCCTTCTGTCCATCTGTCTTGGTATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109515 Nonsense 1775 2089 43 51
ENSDART00000136179 Nonsense 146 457 4 12
ENSDART00000139747   None 363 None 7
ENSDART00000141621   None 565 None 12
ENSDART00000144928   None 323 None 7
Genomic Location (Zv9):
Chromosome 2 (position 22345499)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23232204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTATTATTGCAATGTTTTTGCCCCTGCACAGTATTGAGGGAAGGAAGT[T/A]GCCTCCTCACCAGGTGGAAGTGGATGCCATTCAGAATAACAGCACTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link