myo7bb

Ensembl ID:
ENSDARG00000077201
ZFIN ID:
ZDB-GENE-070912-482
Description:
Novel protein similar to vertebrate myosin VIIA (MYO7A) [Source:UniProtKB/TrEMBL;Acc:B0S8H4]
Human Orthologue:
MYO7B
Human Description:
myosin VIIB [Source:HGNC Symbol;Acc:7607]
Mouse Orthologue:
Myo7b
Mouse Description:
myosin VIIB Gene [Source:MGI Symbol;Acc:MGI:107709]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19737 Essential Splice Site Available for shipment Available now
sa17781 Nonsense Available for shipment Available now
sa5132 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109515 Essential Splice Site 664 2089 None 51
ENSDART00000136179 None None 457 None 12
ENSDART00000139747 None None 363 None 7
ENSDART00000141621 None None 565 None 12
ENSDART00000144928 Essential Splice Site 40 323 None 7
Genomic Location:
Chromosome 2 (position 22371530)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGTGAGGACGCTTTTAAGATGACGTTTTCTCTTTATTTTCCTCATC[A/C]GGTTTTTAACAGAGAGCTCTGCATGCAGCAACTTCGCTACTCTGGAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109515 Nonsense 1124 2089 30 51
ENSDART00000136179 None None 457 None 12
ENSDART00000139747 None None 363 None 7
ENSDART00000141621 None None 565 None 12
ENSDART00000144928 None None 323 None 7
Genomic Location:
Chromosome 2 (position 22357594)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWGAAATTTATTGTCAGATCTGTAAGCAGCTGACAGGCAATAAAAACCGC[A/T]AAAGTGTAAACAGAGGCTGGATCCTTCTGTCCATCTGTCTTGGTATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109515 Essential Splice Site 1618 2089 39 51
ENSDART00000136179 None None 457 None 12
ENSDART00000139747 None None 363 None 7
ENSDART00000141621 None None 565 None 12
ENSDART00000144928 None None 323 None 7
Genomic Location:
Chromosome 2 (position 22347972)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAGTGGCCCACATGACGCTCAAGGAGTTCTCCTTTGATTATTTCAGG[T/C]AACACACATTTGATTTGCAATCATCTTAAGTRATGTAGGATGGATCGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xwholiv0