LOC557716

Ensembl ID:
ENSDARG00000077193
Human Orthologue:
NAGS
Human Description:
N-acetylglutamate synthase [Source:HGNC Symbol;Acc:17996]
Mouse Orthologue:
Nags
Mouse Description:
N-acetylglutamate synthase Gene [Source:MGI Symbol;Acc:MGI:2387600]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31323 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31323
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110343 Nonsense 268 527 3 8
Genomic Location (Zv9):
Chromosome 3 (position 23327877)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22906088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGTCGCTCTTCTGTCCTCCGCTCCATCCAGGTGACCACGGCCATCTCA[C/T]AGACACTACAGCCTCTCAAAGTCATCTTCCTGAACAGCTCAGGGGGAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link