LOC100334297

Ensembl ID:
ENSDARG00000077190
Human Orthologue:
HCN1
Human Description:
hyperpolarization activated cyclic nucleotide-gated potassium channel 1 [Source:HGNC Symbol;Acc:4845
Mouse Orthologue:
Hcn1
Mouse Description:
hyperpolarization-activated, cyclic nucleotide-gated K+ 1 Gene [Source:MGI Symbol;Acc:MGI:1096392]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8952 Nonsense Mutation detected in F1 DNA During 2014
sa9828 Nonsense Available for shipment Available now
sa2904 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa8952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113932 Nonsense 122 593 2 8
Genomic Location:
Chromosome 17 (position 1943304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGATTGAWCTRAAYTGAWMATGTTTTGTCTCCCCCTGCAGGTTCTACT[G/A]GGACTTGATAATGCTCATCATGATGATGGGGAATCTAATTATCATTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113932 Nonsense 322 593 4 8
Genomic Location:
Chromosome 17 (position 1839958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATCTTTTCTTATCTTCTCTCTTAGAACGACTCGTGGGGGAAGCAGTA[C/A]TCWTACGCCCTGTTCAAGGCCATGAGCCACATGTTGTGTATCGGGTATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2904
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113932 Nonsense 382 593 4 8
Genomic Location:
Chromosome 17 (position 1839780)
KASP Assay ID:
554-2771.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTYGTGGGTCACGYCACAGCCCTCATCCAGTCTCTGGACTCGTCCCGA[C/T]GACAGTACCARGAGAAGGTARGCGCAGGGTTTATTATGTRAAGATYTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uas4zlq1