si:ch211-270n8.2

Ensembl ID:
ENSDARG00000077188
ZFIN ID:
ZDB-GENE-081028-60
Description:
Novel protein similar to vertebrate attractin (ATRN) [Source:UniProtKB/TrEMBL;Acc:B7ZDE5]
Human Orthologue:
ATRNL1
Human Description:
attractin-like 1 [Source:HGNC Symbol;Acc:29063]
Mouse Orthologue:
Atrnl1
Mouse Description:
attractin like 1 Gene [Source:MGI Symbol;Acc:MGI:2147749]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14748 Essential Splice Site Available for shipment Available now
sa10964 Nonsense Available for shipment Available now
sa22271 Nonsense Available for shipment Available now
sa12259 Nonsense Available for shipment Available now
sa12330 Nonsense Available for shipment Available now
sa42177 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22272 Nonsense Available for shipment Available now
sa17103 Essential Splice Site Available for shipment Available now
sa10875 Nonsense Available for shipment Available now
sa12385 Nonsense Available for shipment Available now
sa42178 Nonsense Mutation detected in F1 DNA During 2017
sa14797 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089533 Essential Splice Site 144 1400 4 30
ENSDART00000147217   None 812 None 19
Genomic Location (Zv9):
Chromosome 13 (position 20092320)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19832673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTACCACCGTATGTAAAAAGGGCCTGTGTGTTGTTTTCTTGCATGTCT[A/C]GTGGCCTGGTTGTCCCAGAAACGAAAGGAAATGAAACCATCCCAGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089533 Nonsense 260 1400 6 30
ENSDART00000147217   None 812 None 19
Genomic Location (Zv9):
Chromosome 13 (position 20096573)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19836926
KASP Assay ID:
2260-6276.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGTTTAGTCTCTCATCTGACATTTCTTTYCCATCTCAGGTCCCGACTG[C/A]TCTTTAAAGGTTCCTTCGGCTGAGTCCTACTGGTTCCWGCCTAATGTRAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089533 Nonsense 268 1400 6 30
ENSDART00000147217   None 812 None 19
Genomic Location (Zv9):
Chromosome 13 (position 20096595)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19836948
KASP Assay ID:
2260-6277.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCTTTTCCATCTCAGGTCCCGACTGCTCTTTAAAGGTTCCTTCGGCT[G/T]AGTCCTACTGGTTCCTGCCTAATGTGAAGCCTGATGGCCAGTCACTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089533 Nonsense 540 1400 10 30
ENSDART00000147217   None 812 None 19
Genomic Location (Zv9):
Chromosome 13 (position 20109435)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19849788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTCGCTCAGTAACGGGGCCAAATGTTTCTCCTCCGACTTCCTCTCCTA[T/G]GACATCGGTATGGACCACCTGTGACCTTCTTCTCTTATTACAGTAGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089533 Nonsense 745 1400 15 30
ENSDART00000147217 Nonsense 164 812 4 19
Genomic Location (Zv9):
Chromosome 13 (position 20151595)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19891631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCATTCGAAGTGAGCAGGTCTGTAGCAAACTGGTSAACTGCAGGAGTTG[T/A]TCGCTTAACATTAACTGCCAGTGGGAGCCACAACAGCAGGAATGTCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089533 Essential Splice Site 827 1400 16 30
ENSDART00000147217 Essential Splice Site 246 812 5 19
Genomic Location (Zv9):
Chromosome 13 (position 20157250)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19897286
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGAGTTCATCCTGGAGGAGCTGCAGAAGTATCAGCTGCAGGAGCGG[G/A]TGAGTTCAGCTCAAATACTGACGTAGATTTGTCTTGATACGTGATTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22272
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089533 Nonsense 909 1400 18 30
ENSDART00000147217 Nonsense 328 812 7 19
Genomic Location (Zv9):
Chromosome 13 (position 20167476)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19907512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCATTTTCCTCCCCCTAGTGAGTCCAAACCTTAGCGTGCGTCCATGT[A/T]AGATGCCCTGTGCCCTGCGAACCACCTGCGCCAACTGCACCAGCCAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17103
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089533 Essential Splice Site 1081 1400 20 30
ENSDART00000147217 Essential Splice Site 500 812 9 19
Genomic Location (Zv9):
Chromosome 13 (position 20184299)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19924335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTACCTGGTTATTATGGAGRCCCCACTAATGGAGGGAAATGCCAAGG[T/A]AAGATRTTTGTCTTTGTATGTKCAAGGGTTTGTCCCYTTGTCTGTRTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089533 Nonsense 1091 1400 21 30
ENSDART00000147217 Nonsense 510 812 10 19
Genomic Location (Zv9):
Chromosome 13 (position 20208670)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19948706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTMTGTCTTYTCCTCAGCCTGCAGATGTAACAACCATGCCAAYGTCTG[C/A]CACTCCAGCTCAGGGAAATGCTACTGTACCACTAAAGGGGTCAAAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12385
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089533 Nonsense 1137 1400 23 30
ENSDART00000147217 Nonsense 556 812 12 19
Genomic Location (Zv9):
Chromosome 13 (position 20247009)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19987045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCTGTGTTTTTCCTTTCACTTCACTAGATAATCTACTGATAGACTAC[C/T]AGTTCACCTTCAGTCTGCTTCWGGAAGACGATCAGCACTACACTGGTAKT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089533 Nonsense 1277 1400 27 30
ENSDART00000147217 Nonsense 689 812 16 19
Genomic Location (Zv9):
Chromosome 13 (position 20307386)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 20047422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCTGTTTCCTGTCCCTGCTGTTGGTTGCGGCTGTGGTTTGGAAAGTC[A/T]AACAGACGTGCTGGGCATCACGCAGGAGAGAGGTAACATCTGCACAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089533 Essential Splice Site 1324 1400 29 30
ENSDART00000147217 Essential Splice Site 736 812 18 19
Genomic Location (Zv9):
Chromosome 13 (position 20456951)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 20196987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGCAAGAAYCCCCTSTCTCACAGTGAGTTATTTGCTCTTCTTTTCTCTC[A/T]GGCTGGTCCCATAGCCGTGGAGCCATGTTCTGGGAATAGTGCTGCCGTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link