si:ch211-270n8.2
- Ensembl ID:
- ENSDARG00000077188
- ZFIN ID:
- ZDB-GENE-081028-60
- Description:
- Novel protein similar to vertebrate attractin (ATRN) [Source:UniProtKB/TrEMBL;Acc:B7ZDE5]
- Human Orthologue:
- ATRNL1
- Human Description:
- attractin-like 1 [Source:HGNC Symbol;Acc:29063]
- Mouse Orthologue:
- Atrnl1
- Mouse Description:
- attractin like 1 Gene [Source:MGI Symbol;Acc:MGI:2147749]
Alleles
There are 12 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa14748 |
Essential Splice Site |
Available for shipment |
Available now |
sa10964 |
Nonsense |
Available for shipment |
Available now |
sa22271 |
Nonsense |
Available for shipment |
Available now |
sa12259 |
Nonsense |
Available for shipment |
Available now |
sa12330 |
Nonsense |
Available for shipment |
Available now |
sa42177 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa22272 |
Nonsense |
Available for shipment |
Available now |
sa17103 |
Essential Splice Site |
Available for shipment |
Available now |
sa10875 |
Nonsense |
Available for shipment |
Available now |
sa12385 |
Nonsense |
Available for shipment |
Available now |
sa42178 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa14797 |
Essential Splice Site |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa14748
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 13 (position 20092320)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
19832673 |
GRCz11 |
13 |
19963655 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCTTACCACCGTATGTAAAAAGGGCCTGTGTGTTGTTTTCTTGCATGTCT[A/C]GTGGCCTGGTTGTCCCAGAAACGAAAGGAAATGAAACCATCCCAGAAGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10964
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 20096573)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
19836926 |
GRCz11 |
13 |
19967908 |
- KASP Assay ID:
- 2260-6276.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AAAGTTTAGTCTCTCATCTGACATTTCTTTYCCATCTCAGGTCCCGACTG[C/A]TCTTTAAAGGTTCCTTCGGCTGAGTCCTACTGGTTCCWGCCTAATGTRAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22271
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 20096595)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
19836948 |
GRCz11 |
13 |
19967930 |
- KASP Assay ID:
- 2260-6277.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTTCTTTTCCATCTCAGGTCCCGACTGCTCTTTAAAGGTTCCTTCGGCT[G/T]AGTCCTACTGGTTCCTGCCTAATGTGAAGCCTGATGGCCAGTCACTTGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12259
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > G
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 20109435)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
19849788 |
GRCz11 |
13 |
19980770 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ACCTCGCTCAGTAACGGGGCCAAATGTTTCTCCTCCGACTTCCTCTCCTA[T/G]GACATCGGTATGGACCACCTGTGACCTTCTTCTCTTATTACAGTAGCATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12330
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 20151595)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
19891631 |
GRCz11 |
13 |
20022613 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGCATTCGAAGTGAGCAGGTCTGTAGCAAACTGGTSAACTGCAGGAGTTG[T/A]TCGCTTAACATTAACTGCCAGTGGGAGCCACAACAGCAGGAATGTCATGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42177
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000089533 |
Essential Splice Site |
827 |
1400 |
16 |
30 |
ENSDART00000147217 |
Essential Splice Site |
246 |
812 |
5 |
19 |
- Genomic Location (Zv9):
- Chromosome 13 (position 20157250)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
19897286 |
GRCz11 |
13 |
20028268 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGTGGAGTTCATCCTGGAGGAGCTGCAGAAGTATCAGCTGCAGGAGCGG[G/A]TGAGTTCAGCTCAAATACTGACGTAGATTTGTCTTGATACGTGATTTGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22272
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 20167476)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
19907512 |
GRCz11 |
13 |
20038494 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGCATTTTCCTCCCCCTAGTGAGTCCAAACCTTAGCGTGCGTCCATGT[A/T]AGATGCCCTGTGCCCTGCGAACCACCTGCGCCAACTGCACCAGCCAGGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17103
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000089533 |
Essential Splice Site |
1081 |
1400 |
20 |
30 |
ENSDART00000147217 |
Essential Splice Site |
500 |
812 |
9 |
19 |
- Genomic Location (Zv9):
- Chromosome 13 (position 20184299)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
19924335 |
GRCz11 |
13 |
20055317 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TGTTTACCTGGTTATTATGGAGRCCCCACTAATGGAGGGAAATGCCAAGG[T/A]AAGATRTTTGTCTTTGTATGTKCAAGGGTTTGTCCCYTTGTCTGTRTGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10875
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 20208670)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
19948706 |
GRCz11 |
13 |
20079688 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTTTMTGTCTTYTCCTCAGCCTGCAGATGTAACAACCATGCCAAYGTCTG[C/A]CACTCCAGCTCAGGGAAATGCTACTGTACCACTAAAGGGGTCAAAGGAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12385
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 20247009)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
19987045 |
GRCz11 |
13 |
20118027 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AAATCTGTGTTTTTCCTTTCACTTCACTAGATAATCTACTGATAGACTAC[C/T]AGTTCACCTTCAGTCTGCTTCWGGAAGACGATCAGCACTACACTGGTAKT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42178
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 20307386)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
20047422 |
GRCz11 |
13 |
20178404 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAGCTGTTTCCTGTCCCTGCTGTTGGTTGCGGCTGTGGTTTGGAAAGTC[A/T]AACAGACGTGCTGGGCATCACGCAGGAGAGAGGTAACATCTGCACAACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14797
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000089533 |
Essential Splice Site |
1324 |
1400 |
29 |
30 |
ENSDART00000147217 |
Essential Splice Site |
736 |
812 |
18 |
19 |
- Genomic Location (Zv9):
- Chromosome 13 (position 20456951)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
20196987 |
GRCz11 |
13 |
20327969 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TAGCAAGAAYCCCCTSTCTCACAGTGAGTTATTTGCTCTTCTTTTCTCTC[A/T]GGCTGGTCCCATAGCCGTGGAGCCATGTTCTGGGAATAGTGCTGCCGTGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: