Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
impg1a
- Ensembl ID:
- ENSDARG00000077187
- ZFIN ID:
- ZDB-GENE-070424-197
- Description:
- Novel protein similar to vertebrate interphotoreceptor matrix proteoglycan 1 (IMPG1) [Source:UniProt
- Human Orthologue:
- IMPG1
- Human Description:
- interphotoreceptor matrix proteoglycan 1 [Source:HGNC Symbol;Acc:6055]
- Mouse Orthologue:
- Impg1
- Mouse Description:
- interphotoreceptor matrix proteoglycan 1 Gene [Source:MGI Symbol;Acc:MGI:1926876]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa43365 | Nonsense | Mutation detected in F1 DNA | During 2017 |
Mutation Details
- Allele Name:
- sa43365
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2017.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000113649 | Nonsense | 937 | 1269 | 13 | 17 |
| ENSDART00000131825 | None | 98 | None | 2 | |
| ENSDART00000134128 | None | 251 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 20 (position 815342)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 771207 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCACCTGAAGACCTTTTTGAAGTCCTAACAGATATATCAGTAATTTCTT[C/A]GACATCTTTGGAAATCGATTATGGTTCATCAACCGAAAAAGTCCAGTCAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
