impg1a

Ensembl ID:
ENSDARG00000077187
ZFIN ID:
ZDB-GENE-070424-197
Description:
Novel protein similar to vertebrate interphotoreceptor matrix proteoglycan 1 (IMPG1) [Source:UniProt
Human Orthologue:
IMPG1
Human Description:
interphotoreceptor matrix proteoglycan 1 [Source:HGNC Symbol;Acc:6055]
Mouse Orthologue:
Impg1
Mouse Description:
interphotoreceptor matrix proteoglycan 1 Gene [Source:MGI Symbol;Acc:MGI:1926876]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43365 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113649 Nonsense 937 1269 13 17
ENSDART00000131825   None 98 None 2
ENSDART00000134128   None 251 None 5
Genomic Location (Zv9):
Chromosome 20 (position 815342)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 771207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCACCTGAAGACCTTTTTGAAGTCCTAACAGATATATCAGTAATTTCTT[C/A]GACATCTTTGGAAATCGATTATGGTTCATCAACCGAAAAAGTCCAGTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link