NP_957234.1

Ensembl ID:
ENSDARG00000077180
Description:
solute carrier family 37 (glucose-6-phosphate transporter), member 4b [Source:RefSeq peptide;Acc:NP
Mouse Orthologue:
Slc37a4
Mouse Description:
solute carrier family 37 (glucose-6-phosphate transporter), member 4 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34967 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111362 Nonsense 234 453 5 10
Genomic Location (Zv9):
Chromosome 10 (position 40481747)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39197418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTCTAAAGGATTTCCTGCTGTCTCCTTACCTGTGGGTTCTGTCTGCC[G/T]GATACCTGGTTGTGTTTGGGGTAAAGATCGCCTGCACTGACTGGGGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link