LOC559603

Ensembl ID:
ENSDARG00000077174
Human Orthologue:
QSOX2
Human Description:
quiescin Q6 sulfhydryl oxidase 2 [Source:HGNC Symbol;Acc:30249]
Mouse Orthologue:
Qsox2
Mouse Description:
quiescin Q6 sulfhydryl oxidase 2 Gene [Source:MGI Symbol;Acc:MGI:2387194]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2207 Essential Splice Site Available for shipment Available now
sa15428 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111282 Essential Splice Site 108 635 4 12
ENSDART00000127924 None 2 283 1 6
Genomic Location:
Chromosome 5 (position 67856676)
KASP Assay ID:
554-2598.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTGTTATGGTGTGTAACTGACTTGGNTNTTTCTCATTTTGTGTACTGAT[A/C]GGAGCTGACAGAGAGCTTCAGACAGTCAGGCAGTTGATGGTGAACTTCAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111282 Essential Splice Site 173 635 5 12
ENSDART00000127924 None None 283 None 6
Genomic Location:
Chromosome 5 (position 67859617)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACACTGCAGTTATAGTTGAGGACGGAAACTCCTACATAGGGAGAGAGG[T/A]ATGARAAATGGTTTWCCRCTTTTGAGGACAGGATRAAATCATYATTTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q0dmc3tt