si:ch73-83c10.1

Ensembl ID:
ENSDARG00000077165
ZFIN ID:
ZDB-GENE-100922-16
Human Orthologue:
KCNJ3
Human Description:
potassium inwardly-rectifying channel, subfamily J, member 3 [Source:HGNC Symbol;Acc:6264]
Mouse Orthologue:
Kcnj3
Mouse Description:
potassium inwardly-rectifying channel, subfamily J, member 3 Gene [Source:MGI Symbol;Acc:MGI:104742]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15616 Nonsense Available for shipment Available now
sa21426 Nonsense Available for shipment Available now
sa14208 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113975 Nonsense 13 490 1 3
Genomic Location (Zv9):
Chromosome 9 (position 4511320)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4538274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGCARGRTAAGATGTCTGCACTCCGTAAGAAATTTGGAAATGACTAT[C/T]AGGTAGTGACCACTACCTCCTCCAGCCATCTGAAGGACAAGAGGAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113975 Nonsense 39 490 1 3
Genomic Location (Zv9):
Chromosome 9 (position 4511242)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4538196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGAAGGACAAGAGGAGGAAACGACAACGATTTGTGGATAAGAACGGA[C/T]GATGTAACGTCCAGCACGGAAACTTGGGCGGAGAGACCAGCAGATATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113975 Nonsense 279 490 2 3
Genomic Location (Zv9):
Chromosome 9 (position 4505426)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4532380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTAAGAGCCCCTTCTATGAACTTTCACAACACTCCATGCAGACWGAA[C/T]AGTTCGAAATTGTYGTGATTTTGGAGGGTATTGTTGAAACAACWGGTARG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link