LOC562320

Ensembl ID:
ENSDARG00000077162
Human Orthologue:
KIAA1239
Human Description:
KIAA1239 [Source:HGNC Symbol;Acc:29229]
Mouse Orthologues:
3110047P20Rik, 3110047P20Rik
Mouse Descriptions:
RIKEN cDNA 3110047P20 gene Gene [Source:MGI Symbol;Acc:MGI:1920464]
RIKEN cDNA 3110047P20 gene Gene [Source:MGI Symbol;Acc:MGI:1920464]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5448 Nonsense Mutation detected in F1 DNA During 2014
sa1044 Nonsense F2 line generated During 2014
sa21112 Nonsense Mutation detected in F1 DNA During 2014
sa8823 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115355 Nonsense 473 1735 7 7
Genomic Location:
Chromosome 7 (position 61639653)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCCACTGACTTCTCTACTGACCTCCGCACCCTGCTGCAGAGCATCTG[T/A]GAGCAGATTGCCATCAACTATCGGTGCCTGATCCATTTCTTACCAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1044
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115355 Nonsense 501 1735 7 7
Genomic Location:
Chromosome 7 (position 61639736)
KASP Assay ID:
554-0947.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTTCTTACCAAACAAGATCCAGGAGATGAGAGAACTGCTGGTRAATT[T/A]GCTGGGGGAGTCGTCATTCCACCGACCTCTTGTCATTATTCTRGATGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115355 Nonsense 1105 1735 7 7
Genomic Location:
Chromosome 7 (position 61641547)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCAAAGATGTCAGTGTGATTGATTTGCTGTACGGCTGGCCATTGTAT[C/T]AGTTCCATTGCTGGTATGAGGTAACCTGTGTCCAGTGTTCCCCAGATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8823
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115355 Nonsense 1219 1735 7 7
Genomic Location:
Chromosome 7 (position 61641889)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGGTGGGCATAGAGCTCTYAGAGGATCAGCGATCMATTCTAATCTGC[A/T]AAGCAAGAAGYATWGAGGTTYTGGACACCAAAATTTGGAAGATGGCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o7oyj2e9