si:ch211-108g16.2

Ensembl ID:
ENSDARG00000077157
ZFIN ID:
ZDB-GENE-090313-8
Human Orthologue:
SYNPO2
Human Description:
synaptopodin 2 [Source:HGNC Symbol;Acc:17732]
Mouse Orthologue:
Synpo2
Mouse Description:
synaptopodin 2 Gene [Source:MGI Symbol;Acc:MGI:2153070]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9982 Nonsense Available for shipment Available now
sa13742 Nonsense Available for shipment Available now
sa17339 Nonsense Available for shipment Available now
sa16016 Nonsense Available for shipment Available now
sa1204 Essential Splice Site, Missense F2 line generated During 2017

Mutation Details

Allele Name:
sa9982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111550 Nonsense 68 581 1 3
ENSDART00000134192 Nonsense 62 151 2 2
ENSDART00000137869 Nonsense 62 617 2 2
Genomic Location (Zv9):
Chromosome 1 (position 24846551)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25270249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAAGGGAAATTGTGATGCCTCCTCCTCAAGAAAGTAAACAATCYCCA[C/T]AAGATTTMTATGCAAGGCAAGAGAAGCATTATCAAGGGCAGCCATTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13742
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111550 Nonsense 71 581 1 3
ENSDART00000134192 Nonsense 65 151 2 2
ENSDART00000137869 Nonsense 65 617 2 2
Genomic Location (Zv9):
Chromosome 1 (position 24846540)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25270238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTGATGCCTCCTCCTCAAGAAAGTAAACAATCYCCAYAAGATTTMTA[T/A]GCAAGGCAAGAGAAGCATTATCAAGGGCAGCCATTTCAGCTACAGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111550 Nonsense 249 581 1 3
ENSDART00000134192   None 151 None 2
ENSDART00000137869 Nonsense 243 617 2 2
ENSDART00000111550 Nonsense 249 581 1 3
ENSDART00000134192   None 151 None 2
ENSDART00000137869 Nonsense 243 617 2 2
Genomic Location (Zv9):
Chromosome 1 (position 24846008)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25269706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGCAAGCTCCAACAGTCAAGCAGRAAAMTCCTCCACCTGTCCTACCC[A/T]AACCTGTTATCAACCCAGCTCACCCTCTCTGGTCTGCAGWTGGTCATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16016
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111550 Nonsense 249 581 1 3
ENSDART00000134192   None 151 None 2
ENSDART00000137869 Nonsense 243 617 2 2
ENSDART00000111550 Nonsense 249 581 1 3
ENSDART00000134192   None 151 None 2
ENSDART00000137869 Nonsense 243 617 2 2
Genomic Location (Zv9):
Chromosome 1 (position 24846008)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25269706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGCAAGCTCCAACAGTCAAGCAGRAAAMTCCTCCACCTGTCCTACCC[A/T]AACCTGTTATCAACCCAGCTCACCCTCTCTGGTCTGCAGWTGGTCATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1204
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111550 Essential Splice Site 322 581 1 3
ENSDART00000134192   None 151 None 2
ENSDART00000137869 Missense 317 617 2 2
Genomic Location (Zv9):
Chromosome 1 (position 24845786)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25269484
KASP Assay ID:
554-1113.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATAAACTTCGTGCTGGTCCCTCCAAATCCAAAACCCCATGGATAAAG[T/G]CACAAAGTGAAGAGAACTCTGTTGCTTCCTGCCCACCCCAACATCTTAGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link