cbln2b

Ensembl ID:
ENSDARG00000077151
ZFIN ID:
ZDB-GENE-070615-12
Description:
cerebellin 2b precursor [Source:RefSeq peptide;Acc:NP_001092208]
Human Orthologue:
CBLN2
Human Description:
cerebellin 2 precursor [Source:HGNC Symbol;Acc:1544]
Mouse Orthologue:
Cbln2
Mouse Description:
cerebellin 2 precursor protein Gene [Source:MGI Symbol;Acc:MGI:88282]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14385 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14385
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112644 Nonsense 195 201 3 3
ENSDART00000136200 Nonsense 195 201 4 4
Genomic Location:
Chromosome 24 (position 15550304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTGGAAAGAGGGAATCTAATGGGCGGATGGAAATACTCCACGTTCTCT[G/T]GATTTTTAGTCTTTCCTYTATAACTGAATCGCAAAACGCGAWGTTTTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6tkepcmn