ENSDARG00000077141

Ensembl ID:
ENSDARG00000077141
Human Orthologues:
CNTN1, CNTN2, CNTN5
Human Descriptions:
contactin 1 [Source:HGNC Symbol;Acc:2171]
contactin 2 (axonal) [Source:HGNC Symbol;Acc:2172]
contactin 5 [Source:HGNC Symbol;Acc:2175]
Mouse Orthologues:
Cntn1, Cntn2, Cntn5
Mouse Descriptions:
contactin 1 Gene [Source:MGI Symbol;Acc:MGI:105980]
contactin 2 Gene [Source:MGI Symbol;Acc:MGI:104518]
contactin 5 Gene [Source:MGI Symbol;Acc:MGI:3042287]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10948 Nonsense Available for shipment Available now
sa20800 Nonsense Mutation detected in F1 DNA During 2014
sa13744 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075481 Nonsense 720 1015 18 23
Genomic Location:
Chromosome 6 (position 45285746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGTGTTCRATTCTCWTCCTCTTTTCACAGCCTGTGCCCGAGGAGCTA[C/T]AAAATGGAGAAAAGTTTGGATATGTGGTGGCATTTCGTCCGCTTGGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075481 Nonsense 726 1015 18 23
Genomic Location:
Chromosome 6 (position 45285764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCTTTTCACAGCCTGTGCCCGAGGAGCTACAAAATGGAGAAAAGTTT[G/T]GATATGTGGTGGCATTTCGTCCGCTTGGCACTACCACCTGGAAACAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13744
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075481 Essential Splice Site 891 1015 21 23
Genomic Location:
Chromosome 6 (position 45297816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCATAGAACTCATTTTTGAAGTAAACGAGAATATGATTTATGTCTTTT[A/G]GCTCCRAGTCAGCCCCCAGGGAACATYRAGTGGAACCTGACGAACTCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/75u0ty2n