gpr158

Ensembl ID:
ENSDARG00000077134
ZFIN ID:
ZDB-GENE-060130-18
Human Orthologue:
GPR158
Human Description:
G protein-coupled receptor 158 [Source:HGNC Symbol;Acc:23689]
Mouse Orthologue:
Gpr158
Mouse Description:
G protein-coupled receptor 158 Gene [Source:MGI Symbol;Acc:MGI:2441697]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39436 Nonsense Mutation detected in F1 DNA During 2017
sa37822 Nonsense Mutation detected in F1 DNA During 2017
sa39435 Nonsense Mutation detected in F1 DNA During 2017
sa44081 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109040 Nonsense 272 1364 1 12
ENSDART00000136154 Nonsense 272 1002 1 11
Genomic Location (Zv9):
Chromosome 24 (position 6583775)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6471067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGGAATTTCATACCCAGATGGCTCTTGACACTGTCAGCTGGCTTCTA[T/A]GGCCTTAAACCCAACAGGAACCCAGACTTCAGGTAACTTTGTTTACATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109040 Nonsense 688 1364 10 12
ENSDART00000136154 Nonsense 685 1002 10 11
Genomic Location (Zv9):
Chromosome 24 (position 6481345)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6368637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACATGGGGCGGTCTGGGTCATACCTGAATAGCAGTATCACATCTGCTT[G/A]GAGTGAGCACAGTCTGGACCCAGAGGATATCCGGGTAGGTGCCTTACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109040 Nonsense 741 1364 12 12
ENSDART00000136154 Nonsense 710 1002 11 11
Genomic Location (Zv9):
Chromosome 24 (position 6480638)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6367930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATCCACAGGAAGAGCTGAAGAAACTCTACTCTCAACTGGAGATTTAC[A/T]AGAGGAAAAAGATGCTGGCTAACAATCCTCACCTGCAGAAGAAGCGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109040 Nonsense 1235 1364 12 12
ENSDART00000136154   None 1002 None 11
Genomic Location (Zv9):
Chromosome 24 (position 6479156)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6366448
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTTGTTCTTCTCAGGTTCCTAAATCAAAGGAGACCCATGCTATAAAG[A/T]AGGGAAATTCCCCTGTCAGATTATTAGAGTTGGAAAGAGGAAACACAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link