BRSK1 (1 of 2)

Ensembl ID:
ENSDARG00000077124
Description:
BR serine/threonine kinase 1 [Source:HGNC Symbol;Acc:18994]
Human Orthologue:
BRSK1
Human Description:
BR serine/threonine kinase 1 [Source:HGNC Symbol;Acc:18994]
Mouse Orthologue:
Brsk1
Mouse Description:
BR serine/threonine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2685946]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35198 Nonsense Mutation detected in F1 DNA During 2016
sa22011 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110247 Nonsense 182 696 7 21
Genomic Location (Zv9):
Chromosome 12 (position 5311341)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4632923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACTGACCTCACTGTCTTTGGCCTCCTAATTCTGTAGGGTGAGAAATA[T/A]GACGGTAGACGGGCTGACGTGTGGAGCTGTGGAGTCATTCTCTTCGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110247 Essential Splice Site 250 696 8 21
Genomic Location (Zv9):
Chromosome 12 (position 5311711)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4632553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTCTGCTGCGAGGCATGATCGAGGTCAACCCCGAAAAAAGACTCACG[G/A]TGAGAGCACGCTGTTTACTGTCAATATGCATGCTCGGCATGCTAGCCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link