cyp26b1

Ensembl ID:
ENSDARG00000077121
ZFIN ID:
ZDB-GENE-030131-2908
Description:
Cytochrome P450 26B1 [Source:UniProtKB/Swiss-Prot;Acc:Q6EIG3]
Human Orthologue:
CYP26B1
Human Description:
cytochrome P450, family 26, subfamily B, polypeptide 1 [Source:HGNC Symbol;Acc:20581]
Mouse Orthologue:
Cyp26b1
Mouse Description:
cytochrome P450, family 26, subfamily b, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:2176159]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2 Nonsense Available for shipment Available now
sa3 Essential Splice Site Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa2
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110347 Nonsense 46 511 1 6
Genomic Location:
Chromosome 7 (position 26491727)
KASP Assay ID:
554-0011.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGCAGCTCTGGCAGCTGAGGTGGACCGCAACACGGGACAAGAGCTGC[A/T]AGCTGCCCATGCCCAAGGGCTCCATGGGGTTCCCCATCATCGGAGAAACA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
ventral mandibular arch
ZFA:0001273
quality
PATO:0000001
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa3
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110347 Essential Splice Site 143 511 2 6
Genomic Location:
Chromosome 7 (position 26501833)
KASP Assay ID:
554-0398.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACAGTTTGGCCAACTCAATAGGAGACATCCATCGCAAAAGGAGGAAG[G/C]TAAGGTCAATGTCCAGTTGTTTATTAGTCTGATTAGGGCTGGGCTAATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qc44qpd5