arhgef16

Ensembl ID:
ENSDARG00000077114
ZFIN ID:
ZDB-GENE-081104-446
Description:
rho guanine nucleotide exchange factor 16 [Source:RefSeq peptide;Acc:NP_001116755]
Human Orthologue:
ARHGEF16
Human Description:
Rho guanine nucleotide exchange factor (GEF) 16 [Source:HGNC Symbol;Acc:15515]
Mouse Orthologue:
Arhgef16
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 16 Gene [Source:MGI Symbol;Acc:MGI:2446219]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9734 Nonsense Available for shipment Available now
sa17621 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114811 Nonsense 168 606 3 15
ENSDART00000131137 Nonsense 186 662 3 14
ENSDART00000142979 Nonsense 168 606 4 15

The following transcripts of ENSDARG00000077114 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 49261180)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTTATACCATACATACTTCTATAATCTACTTCCAGAGCCACGGTTTTA[T/A]CAGGAAATCAAGGAACGAGGCCTTAACGTCAGCAGCTTGAGCACAGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114811 Essential Splice Site 290 606 5 15
ENSDART00000131137 Essential Splice Site 308 662 5 14
ENSDART00000142979 Essential Splice Site 290 606 6 15

The following transcripts of ENSDARG00000077114 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 49271838)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCATCACCTGTTCTCCAACATATCCGWCATCCAGGATGTCAGCAAACGG[T/C]ACASGCATCCTCTTATGTWCTCAAAAATCTTTCTTTTTTTTTTTCCTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iidr6419