sc:d0413

Ensembl ID:
ENSDARG00000077112
ZFIN ID:
ZDB-GENE-080327-27
Description:
cDNA, clone cssl:d0413 [Source:UniProtKB/TrEMBL;Acc:A8BBH2]
Human Orthologue:
LRRN1
Human Description:
leucine rich repeat neuronal 1 [Source:HGNC Symbol;Acc:20980]
Mouse Orthologue:
Lrrn1
Mouse Description:
leucine rich repeat protein 1, neuronal Gene [Source:MGI Symbol;Acc:MGI:106038]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21203 Nonsense Available for shipment Available now
sa859 Nonsense F2 line generated During 2017
sa1128 Nonsense F2 line generated During 2017
sa38670 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112028 Nonsense 68 735 1 2
Genomic Location (Zv9):
Chromosome 8 (position 9390958)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8807540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGCCAAGACTGTTGACTGCAACGAACTCCATTTGAGCAGGATCCCGT[G/A]GAATATCTCAGTTGATACTCAGGTGCTCCTTCTTCAGAGCAACAATATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa859
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112028 Nonsense 588 735 2 2
Genomic Location (Zv9):
Chromosome 8 (position 9392553)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8809135
KASP Assay ID:
554-0762.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCGGGACAACCAAAGTGGCTTAGTGCTACCGTAAAGATCGACAATCCA[C/T]AGATCAGCTACACCGCGATGGTCCCTGTAGATGTCCAAGAGTACAACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1128
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112028 Nonsense 613 735 2 2
Genomic Location (Zv9):
Chromosome 8 (position 9392630)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8809212
KASP Assay ID:
554-1039.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGATGTCCAAGAGTACAACCTCACCCACCTTCTACCTTCAACAGAGTA[C/A]CAGGTTTGCCTGACTATGGCCGGCACTGAGCAAACCCAGCACTCCTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112028 Nonsense 711 735 2 2
Genomic Location (Zv9):
Chromosome 8 (position 9392922)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8809504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTCCTCTGAATGAACTCTACCCGCCCCTTATTAACCTCTGGGAGAAT[G/T]AGACGGAAAAAGAGAAAGAAGGTGCCGTTGATCCTCAAAACTCACAGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link