LOC798168

Ensembl ID:
ENSDARG00000077103
Human Orthologue:
SEMA4A
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4a
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13803 Nonsense Available for shipment Available now
sa15476 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114601 Nonsense 200 739 6 14
Genomic Location:
Chromosome 16 (position 45892938)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RGACAAAAACGTAATTTCTCGCTGTCATAGYAGAGGAACACACAACAACT[T/A]GGAGCTTGAGACTGTACCGAAATTGCTACAGGGTTTGTTTGTTTTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114601 Essential Splice Site 316 739 8 14
Genomic Location:
Chromosome 16 (position 45891795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATTCWCCAGACAASACRCTGTTCTACGGGGTCTTCACTTCACAACGG[T/C]GACAAACATTTYTAGCAAATGCTCCATCATACTGTTCTGAAAGGTCTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fzbxv9hm