LOC798168

Ensembl ID:
ENSDARG00000077103
Human Orthologue:
SEMA4A
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4a
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13803 Nonsense Available for shipment Available now
sa15476 Essential Splice Site Available for shipment Available now
sa39124 Nonsense Mutation detected in F1 DNA During 2016
sa42800 Nonsense Mutation detected in F1 DNA During 2016
sa36237 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114601 Nonsense 200 739 6 14
Genomic Location:
Chromosome 16 (position 45892938)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RGACAAAAACGTAATTTCTCGCTGTCATAGYAGAGGAACACACAACAACT[T/A]GGAGCTTGAGACTGTACCGAAATTGCTACAGGGTTTGTTTGTTTTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114601 Essential Splice Site 316 739 8 14
Genomic Location:
Chromosome 16 (position 45891795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATTCWCCAGACAASACRCTGTTCTACGGGGTCTTCACTTCACAACGG[T/C]GACAAACATTTYTAGCAAATGCTCCATCATACTGTTCTGAAAGGTCTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114601 Nonsense 533 739 13 14
Genomic Location:
Chromosome 16 (position 45888834)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAACACAGGCGGCAGGACGTGGAAAGAGGAAATGTCACAGAACAGTG[T/A]ATAGAGTTCAGAAATACTGCTGCAGGTAAACCGCTTCTGTGAGAACCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114601 Nonsense 578 739 14 14
Genomic Location:
Chromosome 16 (position 45886216)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAACTGGCGAAGATGACCTGGAGATTCTCAAACAACAGCCTCGTTCCC[C/T]AGTTCCCGTACCTGCAGTGGACGGATGGCAGTCTGGTCTTCCCCGTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114601 Nonsense 735 739 14 14
Genomic Location:
Chromosome 16 (position 45885743)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTACCTCAGGAGCAGCCTCAGAAAGGCACAGAGTCGGACAAAATCTG[C/A]CAGACAGAACTGTAACAAAAGCAGAGCTAAAAGAGCTGTATCAGGGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link