HIPK1 (2 of 2)

Ensembl ID:
ENSDARG00000077095
Description:
homeodomain interacting protein kinase 1 [Source:HGNC Symbol;Acc:19006]
Human Orthologue:
HIPK1
Human Description:
homeodomain interacting protein kinase 1 [Source:HGNC Symbol;Acc:19006]
Mouse Orthologue:
Hipk1
Mouse Description:
homeodomain interacting protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1314873]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38820 Nonsense Mutation detected in F1 DNA During 2017
sa27711 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093052 Nonsense 272 1139 2 17
Genomic Location (Zv9):
Chromosome 11 (position 2634901)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2586639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAAGGGCCACACGTGCTTGGTGTTTGAGATGCTGGAGCAGAACCTGTA[C/A]GACTTCTTGAAGCACAGTAAGTTCAGTCCACTGCCACTACGCCACATCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093052 Essential Splice Site 944 1139 15 17
Genomic Location (Zv9):
Chromosome 11 (position 2656471)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2608209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAGCCTGTGGAGAGCTCCATATCGGCCAAAATCCCACCGGCTCTAGG[C/A]AAGTACTCCATTTCTTGGTCAGTTATTTTATTTTATTCTTTTTATTTCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link