blm

Ensembl ID:
ENSDARG00000077089
ZFIN ID:
ZDB-GENE-070702-5
Human Orthologue:
BLM
Human Description:
Bloom syndrome, RecQ helicase-like [Source:HGNC Symbol;Acc:1058]
Mouse Orthologue:
Blm
Mouse Description:
Bloom syndrome, RecQ helicase-like Gene [Source:MGI Symbol;Acc:MGI:1328362]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23311 Nonsense Mutation detected in F1 DNA During 2014
hu3281 Nonsense Available for shipment Available now
sa16619 Nonsense Available for shipment Available now
sa15754 Nonsense Available for shipment Available now
sa13236 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110746 Nonsense 335 1420 6 23
ENSDART00000142686 Nonsense 354 852 4 11

The following transcripts of ENSDARG00000077089 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 26218566)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTAACAAAAAAGAATCTTCTCGATCTGCCTCAGGCCTGCCAGCACCCT[T/A]GGATCAATCTGCCAAAGGATTAAAAGGTATCATTCATTAATAAATTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110746 Nonsense 522 1420 8 23
ENSDART00000142686 Nonsense 541 852 6 11

The following transcripts of ENSDARG00000077089 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 26220090)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTCAAGGTTGTCCTTCAATGAGTCAAGCAATCAGACTGACCTGTTTTA[T/A]TCCCCCAAGAGAGTGGATTCAGGCAGCAGAAATGCTGACAGCAGTGTTGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110746 Nonsense 628 1420 9 23
ENSDART00000142686 Nonsense 647 852 7 11

The following transcripts of ENSDARG00000077089 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 26220510)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCATTGTTCTAAAACATGTGTTTGCTYTGATCTGCAGAACCTTTGTA[C/A]AGRAACCCAGCTCATGACCGMTTCAGAGGCTTTAACTTTCCTCATAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110746 Nonsense 1134 1420 19 23
ENSDART00000142686 None None 852 None 11

The following transcripts of ENSDARG00000077089 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 26231565)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGACTGGGATGTTCGGAGTTGGAGCAGCTTATTCCAAACACAACGCT[G/T]AGAGGCTCTTTAAGAAGCTGGTGCTGGATAATGTTCTGATGGAGGATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110746 Essential Splice Site 1178 1420 20 23
ENSDART00000142686 None None 852 None 11

The following transcripts of ENSDARG00000077089 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 26231781)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCTTGAGAAACTGCAAAATCTTAATTAATTTCTTTAACCCATTGCA[G/T]GTTGAATTYCATGAGACCGARAGCGCATCCAGCATYAGAAAGCACAGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rdnxg1px