si:ch211-196g2.4

Ensembl ID:
ENSDARG00000077087
ZFIN ID:
ZDB-GENE-081104-160
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R133]
Human Orthologues:
PRRT3, PRRT4
Human Descriptions:
proline-rich transmembrane protein 3 [Source:HGNC Symbol;Acc:26591]
proline-rich transmembrane protein 4 [Source:HGNC Symbol;Acc:37280]
Mouse Orthologues:
Prrt3, Prrt4
Mouse Descriptions:
proline-rich transmembrane protein 3 Gene [Source:MGI Symbol;Acc:MGI:2444810]
proline-rich transmembrane protein 4 Gene [Source:MGI Symbol;Acc:MGI:2141677]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21375 Nonsense Available for shipment Available now
sa41294 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109430 Nonsense 363 985 3 3
ENSDART00000144285   None 322 None 3
Genomic Location (Zv9):
Chromosome 8 (position 48588964)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46427222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGTTTACCGAAAGAGACCAGTCAATATCTGTGGGAACAGTTCCATCTT[T/A]GAAGTCAAACCCTGGCTTTCCTACCCGTGCCCAACCCATTGATCCCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109430 Nonsense 758 985 3 3
ENSDART00000144285   None 322 None 3
Genomic Location (Zv9):
Chromosome 8 (position 48590148)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46428406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGGCTGGACAGGAGCGATCAGGAGCGGACATTAGCAAGAGCCTCATA[C/T]GAAATCGTGACCCACTCAAAGACAGCAATCACGGACGCAATCTGAAGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link