col28a1

Ensembl ID:
ENSDARG00000077084
ZFIN ID:
ZDB-GENE-070705-84
Description:
Novel protein containing collagen triple helix repeat domain [Source:UniProtKB/TrEMBL;Acc:A5WUJ9]
Human Orthologue:
COL28A1
Human Description:
collagen, type XXVIII, alpha 1 [Source:HGNC Symbol;Acc:22442]
Mouse Orthologue:
Col28a1
Mouse Description:
collagen, type XXVIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2685312]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5797 Nonsense F2 line generated During 2014
sa17603 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5797
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112808 None None 1170 None 34
ENSDART00000132934 None None 312 None 7
ENSDART00000143292 Nonsense 89 133 4 6
ENSDART00000144300 None None 313 None 14
Genomic Location:
Chromosome 19 (position 25991040)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGAACATGGAATGCCTGGACAAACAGGATCCAAGGTAAAAGCTTGTTA[C/A]CAGTTAACCAAWGTTGACATTACAGTTCTAGATCATCTCTGTAGGGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112808 None 807 1170 31 34
ENSDART00000132934 None None 312 None 7
ENSDART00000143292 Nonsense 125 133 6 6
ENSDART00000144300 None None 313 None 14
Genomic Location:
Chromosome 19 (position 25991620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGRTGTGGTGTGAAATGCCGGACGAGTCCACTGGAGCTGGTKTTTGTTAT[C/T]GACAGCTCAGAAAGTRTGGGTCCAGATAACTATGAAGTGGTGAAGGATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/htv8zhef