col28a1

Ensembl ID:
ENSDARG00000077084
ZFIN ID:
ZDB-GENE-070705-84
Description:
Novel protein containing collagen triple helix repeat domain [Source:UniProtKB/TrEMBL;Acc:A5WUJ9]
Human Orthologue:
COL28A1
Human Description:
collagen, type XXVIII, alpha 1 [Source:HGNC Symbol;Acc:22442]
Mouse Orthologue:
Col28a1
Mouse Description:
collagen, type XXVIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2685312]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5797 Nonsense F2 line generated During 2015
sa17603 Nonsense Available for shipment Available now
sa29212 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa5797
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112808   None 1170 None 34
ENSDART00000132934   None 312 None 7
ENSDART00000143292 Nonsense 89 133 4 6
ENSDART00000144300   None 313 None 14
Genomic Location:
Chromosome 19 (position 25991040)
KASP Assay ID:
554-3577.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGAACATGGAATGCCTGGACAAACAGGATCCAAGGTAAAAGCTTGTTA[C/A]CAGTTAACCAAWGTTGACATTACAGTTCTAGATCATCTCTGTAGGGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112808   807 1170 31 34
ENSDART00000132934   None 312 None 7
ENSDART00000143292 Nonsense 125 133 6 6
ENSDART00000144300   None 313 None 14
Genomic Location:
Chromosome 19 (position 25991620)
KASP Assay ID:
2261-3337.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGRTGTGGTGTGAAATGCCGGACGAGTCCACTGGAGCTGGTKTTTGTTAT[C/T]GACAGCTCAGAAAGTRTGGGTCCAGATAACTATGAAGTGGTGAAGGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112808 Nonsense 858 1170 31 34
ENSDART00000132934   None 312 None 7
ENSDART00000143292   None 133 6 6
ENSDART00000144300   None 313 None 14
Genomic Location:
Chromosome 19 (position 25991771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGGGTGGTGCTCTACAGTCACGTGGAGGTGGTGGTGGCCAGTCTGCAA[C/T]AGCTGTATGACCAGGCTGCTGTCAAGACTGCTGTGCGCAGGATGCCATAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/htv8zhef