si:ch73-92e7.2

Ensembl ID:
ENSDARG00000077078
ZFIN IDs:
ZDB-GENE-071004-108, ZDB-GENE-071004-108, ZDB-GENE-071004-108, ZDB-GENE-071004-108, ZDB-GENE-081030-2
Description:
hypothetical protein LOC100126120 [Source:RefSeq peptide;Acc:NP_001103318]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29690 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43746 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106329 Essential Splice Site None 452 None 5
ENSDART00000106406   None 452 None 5
ENSDART00000106425   None 452 None 5
ENSDART00000115348   None 452 None 5
ENSDART00000145611   None 16 None 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 1611575)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2352665
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGTCAGCGCTGACGCGTTCATTCAGCGTCGAGTCTTCAGAGCTGAGG[T/G]GAGTCGTTGACGCTTTTTCTCGTGTTTACACGACAATAAAACACACTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106329 Nonsense 232 452 5 5
ENSDART00000106406 Nonsense 232 452 5 5
ENSDART00000106425 Nonsense 232 452 5 5
ENSDART00000115348 Nonsense 232 452 5 5
ENSDART00000145611   None 16 None 2
Genomic Location (Zv9):
Chromosome 22 (position 1763452)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2504542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTATTCATGTTCTGAGTGTGGAAAGAGGTTTACACTGCTGCCATATT[T/A]AAAAAAACACGTTAAGATCCACACTGGTGTGAAAGAGTTCGTCTGCTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link