LOC561438

Ensembl ID:
ENSDARG00000077073
Human Orthologue:
TANC1
Human Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 [Source:HGNC Symbol;Acc:29364]
Mouse Orthologue:
Tanc1
Mouse Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9733 Nonsense Available for shipment Available now
sa11508 Essential Splice Site Available for shipment Available now
sa3591 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109344 Nonsense 447 1771 8 25
Genomic Location:
Chromosome 6 (position 12001806)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGACAGCAGTGAWTTCACGGCTGGTGGCTCTCAGTTGTCATGGTGGA[C/T]GAAWGAGACAGATCGCCTCYAGCAGTCCTGAAGCTACACCTCAGAGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109344 Essential Splice Site 1346 1771 23 25
Genomic Location:
Chromosome 6 (position 11953554)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGGGTTTCCCTCTATCTCAACCTCTCCCGCTGCCGCCGCAAAACCAAC[G/A]TRCGTGACACAAGTATCTTGGAAACCCAGATAAAGCCTTSAATAACMATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109344 Nonsense 1374 1771 24 25
Genomic Location:
Chromosome 6 (position 11952907)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTCTCGAACTCAAGCCAAAGTCCTATGAGGCGTTTTATGCTCGTGCC[A/T]GAGCCAAAAGAAGCAGCAGGTAAACAACCTTCATGCYCGTTTTGATTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dxjeqaz1