C5orf36

Ensembl ID:
ENSDARG00000077072
Description:
chromosome 5 open reading frame 36 [Source:HGNC Symbol;Acc:28532]
Human Orthologue:
C5orf36
Human Description:
chromosome 5 open reading frame 36 [Source:HGNC Symbol;Acc:28532]
Mouse Orthologue:
2210408I21Rik
Mouse Description:
RIKEN cDNA 2210408I21 gene Gene [Source:MGI Symbol;Acc:MGI:1919621]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16473 Essential Splice Site Available for shipment Available now
sa16416 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110431 Essential Splice Site 663 668 12 12
ENSDART00000110431 Essential Splice Site 663 668 12 12
Genomic Location:
Chromosome 5 (position 51917308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGAGCTTTTCAGCAGAAAGTGACTGATTAATGTWCTTGTTCTTCCTC[A/G]GACTAGAAGCTGACACCTAGAGACWGCCCCAGCAAACTTCCAGACATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110431 Essential Splice Site 663 668 12 12
ENSDART00000110431 Essential Splice Site 663 668 12 12
Genomic Location:
Chromosome 5 (position 51917308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGAGCTTTTCAGCAGAAAGTGACTGATTAATGTWCTTGTTCTTCCTC[A/G]GACTAGAAGCTGACACCTAGAGACWGCCCCAGCAAACTTCCAGACATGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hohc3see