si:ch211-11p18.1

Ensembl ID:
ENSDARG00000077068
ZFIN ID:
ZDB-GENE-060503-758
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MTF1]
Human Orthologues:
NLRP12, RNH1
Human Descriptions:
NLR family, pyrin domain containing 12 [Source:HGNC Symbol;Acc:22938]
ribonuclease/angiogenin inhibitor 1 [Source:HGNC Symbol;Acc:10074]
Mouse Orthologue:
Rnh1
Mouse Description:
ribonuclease/angiogenin inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1195456]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32376 Nonsense Available for shipment Available now
sa24079 Nonsense Available for shipment Available now
sa37429 Nonsense Mutation detected in F1 DNA During 2017
sa37430 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37431 Nonsense Mutation detected in F1 DNA During 2017
sa37432 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32376
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106045 Nonsense 37 2192 2 42
ENSDART00000132043   None 256 None 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 9351465)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9382541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAAATCCATCAAACCTGATGGAGCTCACTCTGAGTGGAAATAAACTA[G/T]AAGACTCAGGAGTAGAAAAGATCTGTTCTCTGCTGAAAAATACACAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106045 Nonsense 406 2192 9 42
ENSDART00000132043   None 256 None 5
Genomic Location (Zv9):
Chromosome 22 (position 9359306)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9390382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCAACTGTGTCTCAATGTATAACAAACACTGTTATTTTCTAGTCTTT[C/A]AGACTGCAGCATCAGTGAAGAAGGTTATAAAGCTCTGGCTTCAGCTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106045 Nonsense 530 2192 11 42
ENSDART00000132043   None 256 None 5
Genomic Location (Zv9):
Chromosome 22 (position 9359966)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9391042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTTTTGAACACAGTCTGAAAAACAGCTTTATCTCAGAGGAAGATTG[T/A]CGTGTTCTGGCTGAAGCTTTTAATTCAAACCCATCAAATCTGAGAGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106045 Essential Splice Site 1786 2192 32 42
ENSDART00000132043   None 256 None 5
Genomic Location (Zv9):
Chromosome 22 (position 9383692)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9414768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCTCTGCTCTACTGCAGGATAAACACTGCCAGATCAACACACTCAAG[T/C]GAGTTTTGCACAGTTTATTATGAAGGAGGACAATGTTTTACAGGTGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106045 Nonsense 1892 2192 34 42
ENSDART00000132043   None 256 None 5
Genomic Location (Zv9):
Chromosome 22 (position 9388151)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9419227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACTCAAGCACAGAAGAGTGAAGCAATTTTTTGATGTGCTGAAAAAAT[C/A]AACCTGTAAACTGGAGCGACTGAGGTGAGAAACACTAACAGCTAAGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106045 Nonsense 1898 2192 34 42
ENSDART00000132043   None 256 None 5
Genomic Location (Zv9):
Chromosome 22 (position 9388168)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9419244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGAAGCAATTTTTTGATGTGCTGAAAAAATCAACCTGTAAACTGGAG[C/T]GACTGAGGTGAGAAACACTAACAGCTAAGAAACTGCCTCTTGGAAGTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link