TRAPPC10

Ensembl ID:
ENSDARG00000077064
Description:
trafficking protein particle complex 10 [Source:HGNC Symbol;Acc:11868]
Human Orthologue:
TRAPPC10
Human Description:
trafficking protein particle complex 10 [Source:HGNC Symbol;Acc:11868]
Mouse Orthologue:
Trappc10
Mouse Description:
trafficking protein particle complex 10 Gene [Source:MGI Symbol;Acc:MGI:1336209]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21985 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110257 Nonsense 438 1213 9 25
Genomic Location (Zv9):
Chromosome 11 (position 46175861)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 44993791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGGCCGGTCTGGGCGCAGAGAGAGCTGAAACAGGTGAGGATGACTG[C/A]AGTGAGGATTACTGGCATAGCGGATCACAAATCTCACGGTTCGGGTCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link