RBM6

Ensembl ID:
ENSDARG00000077060
Description:
RNA binding motif protein 6 [Source:HGNC Symbol;Acc:9903]
Human Orthologue:
RBM6
Human Description:
RNA binding motif protein 6 [Source:HGNC Symbol;Acc:9903]
Mouse Orthologue:
Rbm6
Mouse Description:
RNA binding motif protein 6 Gene [Source:MGI Symbol;Acc:MGI:1338037]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20795 Nonsense Available for shipment Available now
sa40771 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40772 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33940 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097273 Nonsense 673 1393 6 23
Genomic Location (Zv9):
Chromosome 6 (position 42607372)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42678426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTAACTAACGCAAATCCATCTGTATTTCAAATGCTGTTCCCAGGTTA[C/A]AGCTTCGATACGGCCTATGTGGAGTTTTTAAACCTCGAGGATGCTGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097273 Essential Splice Site 817 1393 8 23
Genomic Location (Zv9):
Chromosome 6 (position 42611647)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42682701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACGCCAAAACTTACAGTACTCTGATCCAGTTTTTAAAGAAAGCAAAA[G/T]TAAGTCATGTCAGCTGCGACTGAGATTTTTCAATTAAGGAAAATGGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097273 Essential Splice Site 870 1393 9 23
Genomic Location (Zv9):
Chromosome 6 (position 42611888)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42682942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCACCTGGATCCAAATGCTTCTGCTTTGTTGATATGGATTCACATGAG[G/T]TGAGATGTACAGAATTATGATTATAACAAAGACAATATGATGTCTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097273 Nonsense 1105 1393 16 23
Genomic Location (Zv9):
Chromosome 6 (position 42614422)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42685476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTCCTGTGACTCCTGTTGCTGAGGTTATAGCTGTACCCATTAAAGAA[G/T]AGGAAGCCAAGGCGGTTTCAGAGGCTTTGCCAGAGGTGCGGGTGGAAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link