LOC100333282

Ensembl ID:
ENSDARG00000077057
Human Orthologue:
ESCO1
Human Description:
establishment of cohesion 1 homolog 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:24645]
Mouse Orthologue:
Esco1
Mouse Description:
establishment of cohesion 1 homolog 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1925055]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9513 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111891 Nonsense 143 931 1 9
Genomic Location:
Chromosome 24 (position 37691825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAACAGTAGCAGCCATGTTCCCTGTGCAAATAGAGCACAATTACGGA[C/T]GATTGTTTGACATGCAGGCTGAAGAGATYACGCTACCTAAACCTGACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h9sk59e0