LOC100333282

Ensembl ID:
ENSDARG00000077057
Human Orthologue:
ESCO1
Human Description:
establishment of cohesion 1 homolog 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:24645]
Mouse Orthologue:
Esco1
Mouse Description:
establishment of cohesion 1 homolog 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1925055]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9513 Nonsense Available for shipment Available now
sa37943 Nonsense Mutation detected in F1 DNA During 2016
sa30128 Nonsense Mutation detected in F1 DNA During 2016
sa39461 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111891 Nonsense 143 931 1 9
Genomic Location:
Chromosome 24 (position 37691825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAACAGTAGCAGCCATGTTCCCTGTGCAAATAGAGCACAATTACGGA[C/T]GATTGTTTGACATGCAGGCTGAAGAGATYACGCTACCTAAACCTGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111891 Nonsense 144 931 1 9
Genomic Location:
Chromosome 24 (position 37691821)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGTAGCAGCCATGTTCCCTGTGCAAATAGAGCACAATTACGGACGAT[T/A]GTTTGACATGCAGGCTGAAGAGATCACGCTACCTAAACCTGACAAAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111891 Nonsense 647 931 2 9
Genomic Location:
Chromosome 24 (position 37684921)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCATCAGCTAAAGTGCAGCCCAATCCAGCAGTGGAGAGAAAGCTGTG[T/A]GTTCCCACTACCGCAGGTAAAGATTGTGCTGACTTGTTTGTTTGGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111891 Nonsense 656 931 3 9
Genomic Location:
Chromosome 24 (position 37684526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTGTTAGTTTAATTCTTTGTGATGCATGTGTTCACAGATAGTAAGT[C/A]GAAATCCTCTCCTCAGCAAGAAACTGCCCAACAAACACAACTGGAAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link