fam198b

Ensembl ID:
ENSDARG00000077054
ZFIN ID:
ZDB-GENE-100105-1
Human Orthologue:
FAM198B
Human Description:
family with sequence similarity 198, member B [Source:HGNC Symbol;Acc:25312]
Mouse Orthologue:
Fam198b
Mouse Description:
family with sequence similarity 198, member B Gene [Source:MGI Symbol;Acc:MGI:1915909]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13448 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112379 Nonsense 79 479 1 4
Genomic Location:
Chromosome 14 (position 37103011)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATAAACGSCCGGAACTGTGGACTGGAAATGGCGTTTATTCTCAGAGT[A/T]AAACTGACCAGGGCCTCACCGATGGGGAGGTGAATGAATCCGTGAGTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4tx30fl2