PPFIA3

Ensembl ID:
ENSDARG00000077053
Description:
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), al
Human Orthologue:
PPFIA3
Human Description:
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), al
Mouse Orthologue:
Ppfia3
Mouse Description:
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), al

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30834 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40081 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33191 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10550 Nonsense Available for shipment Available now
sa18755 Nonsense Mutation detected in F1 DNA During 2017
sa20029 Nonsense Available for shipment Available now
sa20028 Nonsense Available for shipment Available now
sa40080 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109953 Essential Splice Site 38 1063 2 29
ENSDART00000109953 Essential Splice Site 38 1063 2 29
Genomic Location (Zv9):
Chromosome 3 (position 30248935)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29966974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGACAAGGTCTCCCTGTTGAGTCATAGTCTATTGTTCTTCTCTCCCTC[A/C]GGTTCGTGAGAGATTGCGTGTGGCTTTAGAGAGAGTTGCCGTTCTAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109953 Essential Splice Site 38 1063 2 29
ENSDART00000109953 Essential Splice Site 38 1063 2 29
Genomic Location (Zv9):
Chromosome 3 (position 30248935)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29966974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGACAAGGTCTCCCTGTTGAGTCATAGTCTATTGTTCTTCTCTCCCTC[A/C]GGTTCGTGAGAGATTGCGTGTGGCTTTAGAGAGAGTTGCCGTTCTAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109953 Essential Splice Site 490 1063 14 29
Genomic Location (Zv9):
Chromosome 3 (position 30226839)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29944878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGCTATCATGTTGCAGGAGCAGCTGGAGGCCATCAACAAAGAAATAAA[G/T]TGAGTTCACTGCAGACAGAGAGACCTTGAGGACGACTTGGAAAAACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109953 Nonsense 594 1063 16 29
Genomic Location (Zv9):
Chromosome 3 (position 30224201)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29942240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCTCTGGCCYTACTGGACTCCACCCCTCCTCCCACCCCTCGTGCGCTA[C/T]GATTGGACAGGATGACACACACTCACCCTGGTGCATTGCTGGATGACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109953 Nonsense 849 1063 23 29
Genomic Location (Zv9):
Chromosome 3 (position 30213012)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29931051
KASP Assay ID:
2259-3556.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGCAATGACTGGCTGCCCAGTCTGGGTTTGCCCCAGTACAGAAGCTA[C/G]TTCATGGAGTCTCTTGTGGATGCCCGCATGTTGGACCATCTGACCAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20029
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109953 Nonsense 865 1063 23 29
Genomic Location (Zv9):
Chromosome 3 (position 30212966)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29931005
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTACTTCATGGAGTCTCTTGTGGATGCCCGCATGTTGGACCATCTGACC[A/T]AGAAAGAGCTGCGTGGCCAGCTGAAAATGGTGGACAGTTTCCACAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20028
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109953 Nonsense 917 1063 25 29
Genomic Location (Zv9):
Chromosome 3 (position 30206838)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29924877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTGTTCACTGTCTGGTGTTTGTGTTTCTGCTGTAGATGTGATGGTGT[G/A]GTCGAACGAGCGTGTGATGTGCTGGGTTCAGTCCATCGGCTTGAAGGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109953 Nonsense 956 1063 25 29
Genomic Location (Zv9):
Chromosome 3 (position 30206720)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29924759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGCGGTGTTCATGGAGCGCTGTTGGCCCTGGATGACACCTTCGATTA[C/A]ACTGACCTCGCACTGCTCCTGCAGATTCCCAATCAAAACACACAGGTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link