LOC559514

Ensembl ID:
ENSDARG00000077052
Human Orthologue:
TNRC18
Human Description:
trinucleotide repeat containing 18 [Source:HGNC Symbol;Acc:11962]
Mouse Orthologue:
Tnrc18
Mouse Description:
trinucleotide repeat containing 18 Gene [Source:MGI Symbol;Acc:MGI:3648294]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15126 Nonsense Available for shipment Available now
sa1164 Essential Splice Site Confirmed mutation in F2 line During 2014
sa20097 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15126
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103486 Nonsense 477 2925 4 29
Genomic Location:
Chromosome 3 (position 40438593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAGAGACATTTTACGAGAGGAAGGCTCGATAATTAGGTCAAATGGTT[T/A]GGCCATGAAAAAGCCTTTGCATTTGGAAATGTGCACAAATAAATCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1164
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103486 Essential Splice Site 1553 2925 13 29
Genomic Location:
Chromosome 3 (position 40451066)
KASP Assay ID:
554-1074.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGTGCGCTGTCTCCACCCTCCAGCAAGTTGGATTCGAGATGTGCAAA[G/A]TGAGTATGGAGCTCGGGCACCGTTAAGGYCCAGCTGTGCTCCACACAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103486 Nonsense 1980 2925 18 29
Genomic Location:
Chromosome 3 (position 40462467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCCCGGGAGTTCAGTTTTGACCTTACAGCGGATGGGAGTGAAGACGAA[C/T]AGTGGACACGGCGGAGGAGCGAACGCATCTTCCTCCATGATGCTGCTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tdyozchn