LOC559514

Ensembl ID:
ENSDARG00000077052
Human Orthologue:
TNRC18
Human Description:
trinucleotide repeat containing 18 [Source:HGNC Symbol;Acc:11962]
Mouse Orthologue:
Tnrc18
Mouse Description:
trinucleotide repeat containing 18 Gene [Source:MGI Symbol;Acc:MGI:3648294]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33269 Nonsense Mutation detected in F1 DNA During 2016
sa15126 Nonsense Available for shipment Available now
sa33270 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1164 Essential Splice Site Confirmed mutation in F2 line During 2016
sa33271 Nonsense Mutation detected in F1 DNA During 2016
sa20097 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103486 Nonsense 325 2925 4 29
Genomic Location (Zv9):
Chromosome 3 (position 40438136)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40301496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGGACGATGAAACCATCCGACCAGGGGGCCACCTTTCTAACGACAAA[C/T]AGAAAAGATGCGATTCAGTTGCTACATCAGCTGGCACTCTGCATGTTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15126
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103486 Nonsense 477 2925 4 29
Genomic Location (Zv9):
Chromosome 3 (position 40438593)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40301953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAGAGACATTTTACGAGAGGAAGGCTCGATAATTAGGTCAAATGGTT[T/A]GGCCATGAAAAAGCCTTTGCATTTGGAAATGTGCACAAATAAATCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103486 Essential Splice Site 1459 2925 12 29
Genomic Location (Zv9):
Chromosome 3 (position 40450661)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40314021
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCTGCTGTTTGGAGTCAAGCTACAGACATTAATCTTGCTTTTTCACTT[A/T]GATGTTCTCCAAATCCTCTTTGGAGGGAATGGATGCCGCAGAAGTAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1164
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103486 Essential Splice Site 1553 2925 13 29
Genomic Location (Zv9):
Chromosome 3 (position 40451066)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40314426
KASP Assay ID:
554-1074.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGTGCGCTGTCTCCACCCTCCAGCAAGTTGGATTCGAGATGTGCAAA[G/A]TGAGTATGGAGCTCGGGCACCGTTAAGGYCCAGCTGTGCTCCACACAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103486 Nonsense 1620 2925 15 29
Genomic Location (Zv9):
Chromosome 3 (position 40451568)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40314928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATACTCATTTGGTGCAATCTCTATTGACAGGTCCCAAAAATGGCTGTG[A/T]AGAAGAGCCGAGTAAGCGAGCAGGAGCAGTTGGCATCCAAACTCGACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20097
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103486 Nonsense 1980 2925 18 29
Genomic Location (Zv9):
Chromosome 3 (position 40462467)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40325827
KASP Assay ID:
2259-3923.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCCCGGGAGTTCAGTTTTGACCTTACAGCGGATGGGAGTGAAGACGAA[C/T]AGTGGACACGGCGGAGGAGCGAACGCATCTTCCTCCATGATGCTGCTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link