
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
C7U117_DANRE
- Ensembl ID:
- ENSDARG00000077047
- Description:
- Protein-tyrosine phosphatase IA-2a [Source:UniProtKB/TrEMBL;Acc:C7U117]
- Human Orthologue:
- PTPRN
- Human Description:
- protein tyrosine phosphatase, receptor type, N [Source:HGNC Symbol;Acc:9676]
- Mouse Orthologue:
- Ptprn
- Mouse Description:
- protein tyrosine phosphatase, receptor type, N Gene [Source:MGI Symbol;Acc:MGI:102765]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9653 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9653
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109144 | Essential Splice Site | 74 | 245 | 3 | 9 |
- Genomic Location (Zv9):
- Chromosome 6 (position 13880668)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 13840630 GRCz11 6 13970067 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCAGAGTGAAAGTAACATCAAGAAGAACCGCTGCTCGGATGCCGTGYCCT[G/T]TGAGTACTCCCTYACCCYWCTGTCTCTCTTAAAACTCCTTCATTTTTTAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: