LOC565615

Ensembl ID:
ENSDARG00000077040
Human Orthologue:
RIN2
Human Description:
Ras and Rab interactor 2 [Source:HGNC Symbol;Acc:18750]
Mouse Orthologue:
Rin2
Mouse Description:
Ras and Rab interactor 2 Gene [Source:MGI Symbol;Acc:MGI:1921280]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9275 Nonsense Mutation detected in F1 DNA During 2014
sa20620 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110920 Nonsense 536 791 9 12
Genomic Location:
Chromosome 6 (position 6755003)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCAGCGCTGCATGAGTTYCAGGCRGCCGCTGGAGTCTGGCAGAMGCTG[C/T]AGGAGAATCTGGCTATTGCCAAAACCAAACGACCCAATGAGCTGGGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110920 Nonsense 767 791 12 12
Genomic Location:
Chromosome 6 (position 6762707)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCCTGACGGACGAAAGCAGTCAGCAGTTGGCCGCAGACACACACCCG[C/T]AGTGGATAAAAGCAGAGTTACACAGTCGACCAAACCGACAGCCCTTTCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/szraih7y