esama

Ensembl ID:
ENSDARG00000077039
ZFIN ID:
ZDB-GENE-090629-1
Description:
endothelial cell adhesion molecule a [Source:RefSeq peptide;Acc:NP_001108538]
Human Orthologues:
C1orf204, ESAM
Human Descriptions:
chromosome 1 open reading frame 204 [Source:HGNC Symbol;Acc:27647]
endothelial cell adhesion molecule [Source:HGNC Symbol;Acc:17474]
Mouse Orthologue:
Esam
Mouse Description:
endothelial cell-specific adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1916774]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8787 Nonsense Mutation detected in F1 DNA During 2016
sa21761 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115251 Nonsense 122 428 3 7
Genomic Location (Zv9):
Chromosome 10 (position 32674713)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31776062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCTGTACATTAACAACACCAAARTATCAGACTCWGGGCRGTACGTGTG[C/A]CAGGTCATGATCCCCGGGGCCTCAGGACTCACTGGAACACTAAACCTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115251 Essential Splice Site 235 428 6 7
Genomic Location (Zv9):
Chromosome 10 (position 32680175)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31781524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAAAAAGAAATGTGGTAAACACTAACTTTGTCTGTTCCTTTTGCACA[G/C]CGACAAATGCCGGAATGATCGCTGGCGTTACATTCGGCTGTATAGTGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link