pbrm1l

Ensembl ID:
ENSDARG00000077038
ZFIN ID:
ZDB-GENE-010501-3
Description:
Polybromo 1, like [Source:UniProtKB/TrEMBL;Acc:Q4KM18]
Human Orthologue:
PBRM1
Human Description:
polybromo 1 [Source:HGNC Symbol;Acc:30064]
Mouse Orthologue:
Pbrm1
Mouse Description:
polybromo 1 Gene [Source:MGI Symbol;Acc:MGI:1923998]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20804 Nonsense Available for shipment Available now
sa33952 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064868 Nonsense 7 449 2 12
ENSDART00000103472   None 454 None 7
ENSDART00000131203 Nonsense 7 1648 1 30
ENSDART00000132845 Nonsense 7 1575 2 29
ENSDART00000138567 Nonsense 7 1629 2 30

The following transcripts of ENSDARG00000077038 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 46346785)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46407719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTGGATTATTGGAACAGGTACTGTCTCAATGGGCTCCAAGAGAAGA[C/T]GAGCCACCTCTCCCTCCAGCAGTGCCAGCGGAGGAGACTTTGACGATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064868 Nonsense 183 449 6 12
ENSDART00000103472   None 454 None 7
ENSDART00000131203 Nonsense 183 1648 5 30
ENSDART00000132845 Nonsense 183 1575 6 29
ENSDART00000138567 Nonsense 183 1629 6 30

The following transcripts of ENSDARG00000077038 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 46348243)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46409177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATATTTTTCCCTGTGTACATTTGTAATTAACAGAGACCACCAAGCTA[T/G]TTAAAAGCCATACTGGAGCAGCTCTTGGAGGCCATCGCATCCTGCACTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link