uba2

Ensembl ID:
ENSDARG00000077024
ZFIN ID:
ZDB-GENE-040426-2681
Description:
SUMO-activating enzyme subunit 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXG4]
Human Orthologue:
UBA2
Human Description:
ubiquitin-like modifier activating enzyme 2 [Source:HGNC Symbol;Acc:30661]
Mouse Orthologue:
Uba2
Mouse Description:
ubiquitin-like modifier activating enzyme 2 Gene [Source:MGI Symbol;Acc:MGI:1858313]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15421 Nonsense Available for shipment Available now
sa24623 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12884 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109358 Nonsense 31 651 1 17
ENSDART00000110459 Nonsense 31 650 1 17
ENSDART00000144042 None None 371 None 10

The following transcripts of ENSDARG00000077024 do not overlap with this mutation:

Genomic Location:
Chromosome 25 (position 13126484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCTCTCCTCCTGCCGGGTGCTGGTGGTCGGGGCGGGAGGCATYGGCTG[C/A]GAGCTYCTGAAAAACCTGGTGCTCACCGGCTTTAAGAAWATTGAGGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109358 Essential Splice Site 99 651 3 17
ENSDART00000110459 Essential Splice Site 99 650 3 17
ENSDART00000144042 None None 371 None 10

The following transcripts of ENSDARG00000077024 do not overlap with this mutation:

Genomic Location:
Chromosome 25 (position 13127991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTTGTCCATCTGCAAACATCACTGCCTATCACGACAGCATCATGAAG[T/C]AAGTGCAGTAACGTTATTGCCAAAAAAAACTTTGTAAATTTGTTTGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109358 Nonsense 117 651 4 17
ENSDART00000110459 Nonsense 117 650 4 17
ENSDART00000144042 None None 371 None 10

The following transcripts of ENSDARG00000077024 do not overlap with this mutation:

Genomic Location:
Chromosome 25 (position 13128143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTACAATGTGGAGTTCTTCAGGAATTTCCAGCTTGTAATGAATGCTT[T/A]GGACAACAGAGGTGTGAATTAGTTTYTGCAAATATTAACGTGAAGGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x2rnzqki