si:ch73-90n13.2

Ensembl ID:
ENSDARG00000077011
ZFIN ID:
ZDB-GENE-090312-82
Human Orthologue:
UHRF1BP1
Human Description:
UHRF1 binding protein 1 [Source:HGNC Symbol;Acc:21216]
Mouse Orthologue:
Uhrf1bp1
Mouse Description:
UHRF1 (ICBP90) binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:3041238]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43897 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43896 Nonsense Mutation detected in F1 DNA During 2017
sa37579 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114486 Essential Splice Site 590 1353 12 20
ENSDART00000132671   None 149 None 3
ENSDART00000134183 Essential Splice Site 81 160 2 3
ENSDART00000140986   None 414 None 10
ENSDART00000146416   None 144 None 4
Genomic Location (Zv9):
Chromosome 23 (position 346963)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 317954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGACTGACGAACACATCGATATACGCCTGGATGCAACACAGCTGAAG[G/A]TAAACCAAGATCTGTCTGTCTATCTATCTATCTATCTATCTATCTATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114486 Nonsense 934 1353 13 20
ENSDART00000132671   None 149 None 3
ENSDART00000134183   None 160 None 3
ENSDART00000140986   None 414 None 10
ENSDART00000146416   None 144 None 4
Genomic Location (Zv9):
Chromosome 23 (position 344122)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 315113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAGTGTTGCTCCTACAACTCCTCCGGTTTCCCCTGGGAACTCTGCGT[T/A]ATTGTCCCGGCACAGCTCTACTTTCAGCATTGAGGGGGATTTTTCCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114486 Nonsense 1264 1353 18 20
ENSDART00000132671   None 149 None 3
ENSDART00000134183   None 160 None 3
ENSDART00000140986   None 414 None 10
ENSDART00000146416 Nonsense 72 144 2 4
Genomic Location (Zv9):
Chromosome 23 (position 337939)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 308930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCGCTCCTCAGCCCGTCCCGGTGCTCTTCTCTCTGGATAATGTAGTGT[T/A]GGAGCGTCTGGATGATGGAGTGCTGCGCTTCAGACGTGAGTGCTTTAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link