ABCC8 (3 of 3)

Ensembl ID:
ENSDARG00000077007
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
Human Orthologue:
ABCC8
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
Mouse Orthologue:
Abcc8
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 Gene [Source:MGI Symbol;Acc:MGI:1352629]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18215 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098668 Essential Splice Site 32 562 2 14
Genomic Location:
Chromosome 18 (position 48913062)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAACTGTWGGAAAGYGTTCAGCAGTGTTTTCAGTGTGTGTTTCTCWGT[A/G]GATTATAGCCATGCGGGACGGGACGGKACAGACTCAGGGGACTCTGAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3uqtfhpd