aldh1l1

Ensembl ID:
ENSDARG00000077004
ZFIN ID:
ZDB-GENE-100519-4
Description:
aldehyde dehydrogenase 1 family, member L1 [Source:RefSeq peptide;Acc:NP_001185701]
Human Orthologue:
ALDH1L1
Human Description:
aldehyde dehydrogenase 1 family, member L1 [Source:HGNC Symbol;Acc:3978]
Mouse Orthologue:
Aldh1l1
Mouse Description:
aldehyde dehydrogenase 1 family, member L1 Gene [Source:MGI Symbol;Acc:MGI:1340024]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20698 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18221 Splice Site, Nonsense Available for shipment Available now
sa12463 Nonsense Available for shipment Available now
sa20699 Nonsense Mutation detected in F1 DNA During 2014
sa15821 Essential Splice Site Available for shipment Available now
sa20700 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112636 Essential Splice Site 240 904 5 23
Genomic Location:
Chromosome 6 (position 23763619)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAGGAAATGACAGAGTACCTGGAGCCTGGGCAGAGATAGATGGCAAA[G/A]TGAGTGTTTTTCCTCTTAACAACAACAATACACCAAACATGCTCTCTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112636 Splice Site, Nonsense 450 904 11 23
Genomic Location:
Chromosome 6 (position 23772498)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGKATGCGGAAGGRGGAAARACCTATAAGAGCATTAACCCTACTGACGGA[C/T]AAGTACATACTGGGCACACATCTCTTTTTCTATTCATANTTTTTCCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112636 Nonsense 457 904 12 23
Genomic Location:
Chromosome 6 (position 23772606)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTCAATATCAACTTCTGTTTGYGTGTAGGYAATCTGYGACGTGTCTT[T/A]AGCTCAGATCTCTGATGTGGAAAAAGCAGTCGCTGCAGCTAAAGAAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112636 Nonsense 553 904 14 23
Genomic Location:
Chromosome 6 (position 23777592)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCTAATATTATTTTCCACAGGGCTGCACTATTCCCATAAACCAGGCT[C/T]GACCTAATCGAAACCTTACCTTTACCAAGAAAGAGCCCATTGGGTAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15821
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112636 Essential Splice Site 632 904 17 23
Genomic Location:
Chromosome 6 (position 23778237)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTAACTGCTTGYAGATGAATWGCATTTTTATYAAATKTGTACATTTCA[G/A]GGTCTTTGGTTGGTCAGCGACTYTCTGAYCAYCCKGATGTCCGMAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112636 Nonsense 899 904 23 23
Genomic Location:
Chromosome 6 (position 23786126)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTCCATACAGGTCAAGAAGCTCTGAATGAGTATCTGAAGACTAAATG[T/A]GTCACAGTGGAATACTAACTGACAAAACACTGGACGTATAGTAAAGATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Genetic variants associated with glycine metabolism and their role in insulin sensitivity and type 2 diabetes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mfq50rvz