si:ch73-92i20.1

Ensembl ID:
ENSDARG00000076998
ZFIN ID:
ZDB-GENE-070705-270
Description:
Novel protein similar to vertebrate GRB2-associated binding protein 2 (GAB2) [Source:UniProtKB/TrEMB
Human Orthologue:
GAB3
Human Description:
GRB2-associated binding protein 3 [Source:HGNC Symbol;Acc:17515]
Mouse Orthologue:
Gab3
Mouse Description:
growth factor receptor bound protein 2-associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:2387324]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38463 Nonsense Mutation detected in F1 DNA During 2017
sa44603 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099366 Nonsense 107 633 2 10
ENSDART00000148092   None 148 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23692124)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21404996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTAATCTAATTCTTTCTCTCCCTCTCTCAGTCATGGCGAAAGAGATG[G/A]TTTGTTTTACGGAGGGGTCGGATGAGCGGGAATCCTGACGTTTTGGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099366 Nonsense 619 633 10 10
ENSDART00000148092   None 147 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23714917)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATACAGGGTGGACTATGTGAAGGTAGATGAGAAGAAGACCCAGGCTTTA[C/T]AAAGCACCAAGATGGAGTGGAAGGATGTCCGTCAGTCAAAACCTTAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link