LOC566321

Ensembl ID:
ENSDARG00000076996
Human Orthologue:
IPO13
Human Description:
importin 13 [Source:HGNC Symbol;Acc:16853]
Mouse Orthologue:
Ipo13
Mouse Description:
importin 13 Gene [Source:MGI Symbol;Acc:MGI:2385205]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39762 Nonsense Mutation detected in F1 DNA During 2016
sa13443 Nonsense Available for shipment Available now
sa19666 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115202 Nonsense 49 961 3 22
Genomic Location (Zv9):
Chromosome 2 (position 5818480)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6264208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCTTTACTATGATCCTGATATGGGGAAGAAGAATGTGGCCCAGAAGT[G/A]GCTCTCAGAAGCCCAAGCATCACCGCAAGCTTGGCAATTCTGCTGGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115202 Nonsense 363 961 6 22
Genomic Location (Zv9):
Chromosome 2 (position 5813741)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6259469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACACTATCCAGTGGACGAGACCTCCAGCTCCCTCACGCTCACATTTT[G/A]GTACACCCTACAGGTACAAGTCCACCCAGAAACATCAMTGAAACATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115202 Nonsense 492 961 9 22
Genomic Location (Zv9):
Chromosome 2 (position 5811202)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6256930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTGAGACCGTAGATGTCAGCTATTCGGACGTCATTCCAGGACTGATC[G/T]GATTGATTCCTCTCATCACAGCAAACAACATTCAACTGGCCGAGACCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link