SHARPIN (2 of 2)

Ensembl ID:
ENSDARG00000076995
Description:
SHANK-associated RH domain interactor [Source:HGNC Symbol;Acc:25321]
Human Orthologue:
SHARPIN
Human Description:
SHANK-associated RH domain interactor [Source:HGNC Symbol;Acc:25321]
Mouse Orthologue:
Sharpin
Mouse Description:
SHANK-associated RH domain interacting protein Gene [Source:MGI Symbol;Acc:MGI:1913331]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39737 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031805 Essential Splice Site 292 361 8 10
Genomic Location (Zv9):
Chromosome 2 (position 381435)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 348103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAACGGGCTCTCCGTGCCCACAGCGGCTCCAGCAAACGCTTCACTTTC[A/T]GCCCCGGCGGGCGGCGGCAGCAGCGGGCACGACTGGAGGGCGTACAGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link